Monday, January 26, 2009

RNA secondary structure prediction

Exercise 1

Copy the following sequence

>1QTQ:B|PDBID|CHAIN|SEQUENCE
UGGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGCAUUCCGAGGUUCGAAUCCUCGUACCCCAGCCA

click on the link below and paste the above copied sequence in the text box area and then click the submit/proceed button to predict the secondary structure of the RNA sequence

RNA fold Web server

RNA secondary structure prediction

Wednesday, January 21, 2009

The Cell

For biologists the cell is the functional and structural unit of all known living organisms.

For gamers :-

Cell is a microprocessor architecture jointly developed by Sony Computer Entertainment, Toshiba, and IBM, an alliance known as "STI". The architectural design and first implementation were carried out at the STI Design Center in Austin, Texas over a four-year period beginning March 2001 on a budget reported by IBM as approaching US$400 million.[1] Cell is shorthand for Cell Broadband Engine Architecture, commonly abbreviated CBEA in full or Cell BE in part. Cell combines a general-purpose Power Architecture core of modest performance with streamlined coprocessing elements which greatly accelerate multimedia and vector processing applications, as well as many other forms of dedicated computation.

The first major commercial application of Cell was in Sony's PlayStation 3 game console.

Check out Cell Project at IBM