Exercise 1
Copy the following sequence
>1QTQ:B|PDBID|CHAIN|SEQUENCE
UGGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGCAUUCCGAGGUUCGAAUCCUCGUACCCCAGCCA
click on the link below and paste the above copied sequence in the text box area and then click the submit/proceed button to predict the secondary structure of the RNA sequence
RNA fold Web server
RNA secondary structure prediction
I want to know how God created this world. I am not interested in this or that phenomenon, in the spectrum of this or that element. I want to know His thoughts; the rest are details. Albert Einstein
Monday, January 26, 2009
RNA secondary structure prediction
Wednesday, January 21, 2009
The Cell
For biologists the cell is the functional and structural unit of all known living organisms.
For gamers :-
Cell is a microprocessor architecture jointly developed by Sony Computer Entertainment, Toshiba, and IBM, an alliance known as "STI". The architectural design and first implementation were carried out at the STI Design Center in Austin, Texas over a four-year period beginning March 2001 on a budget reported by IBM as approaching US$400 million.[1] Cell is shorthand for Cell Broadband Engine Architecture, commonly abbreviated CBEA in full or Cell BE in part. Cell combines a general-purpose Power Architecture core of modest performance with streamlined coprocessing elements which greatly accelerate multimedia and vector processing applications, as well as many other forms of dedicated computation.
The first major commercial application of Cell was in Sony's PlayStation 3 game console.
Check out Cell Project at IBM
For gamers :-
Cell is a microprocessor architecture jointly developed by Sony Computer Entertainment, Toshiba, and IBM, an alliance known as "STI". The architectural design and first implementation were carried out at the STI Design Center in Austin, Texas over a four-year period beginning March 2001 on a budget reported by IBM as approaching US$400 million.[1] Cell is shorthand for Cell Broadband Engine Architecture, commonly abbreviated CBEA in full or Cell BE in part. Cell combines a general-purpose Power Architecture core of modest performance with streamlined coprocessing elements which greatly accelerate multimedia and vector processing applications, as well as many other forms of dedicated computation.
The first major commercial application of Cell was in Sony's PlayStation 3 game console.
Check out Cell Project at IBM
Tuesday, January 20, 2009
Subscribe to:
Comments (Atom)