RNA secondary structure prediction

Exercise 1

Copy the following sequence

>1QTQ:B|PDBID|CHAIN|SEQUENCE
UGGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGCAUUCCGAGGUUCGAAUCCUCGUACCCCAGCCA

click on the link below and paste the above copied sequence in the text box area and then click the submit/proceed button to predict the secondary structure of the RNA sequence

RNA fold Web server

RNA secondary structure prediction

Online Sequence Analysis Tools .. Up and Running!!

A new site dedicated to sequence analysis is developed and hosted at http://rohitfarmer.100webspace.net. Presently the site host two online tools for nucleic acid and protein sequence analysis. NucProp the nucleic acid sequence analysis tool analyses various biochemical and physical properties of DNA sequence. whereas ProtProp analyses various biochemical and physical chemical properties of amino acid sequence such as amino acid composition, molecular weight, extinction coefficient etc. Right now its a Beta release.

Click the below link to test the tools.

Online Sequence Analysis Tools