Lecture notes for Alignment ....
Download Link
Showing posts with label Notes. Show all posts
Showing posts with label Notes. Show all posts
Monday, April 25, 2011
Monday, January 26, 2009
RNA secondary structure prediction
Exercise 1
Copy the following sequence
>1QTQ:B|PDBID|CHAIN|SEQUENCE
UGGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGCAUUCCGAGGUUCGAAUCCUCGUACCCCAGCCA
click on the link below and paste the above copied sequence in the text box area and then click the submit/proceed button to predict the secondary structure of the RNA sequence
RNA fold Web server
RNA secondary structure prediction
Copy the following sequence
>1QTQ:B|PDBID|CHAIN|SEQUENCE
UGGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGCAUUCCGAGGUUCGAAUCCUCGUACCCCAGCCA
click on the link below and paste the above copied sequence in the text box area and then click the submit/proceed button to predict the secondary structure of the RNA sequence
RNA fold Web server
RNA secondary structure prediction
Tuesday, January 20, 2009
Wednesday, September 17, 2008
Tuesday, September 2, 2008
Wednesday, August 20, 2008
Saturday, August 9, 2008
Friday, August 1, 2008
Lecture notes on Internet
Lecture notes on internet ... for B.tech Biotechnology (IM,BT,GE) Vth sem and Bsc. (Hon) Biotechnology.
Download Link
Download Link
Subscribe to:
Posts (Atom)