Monday, January 26, 2009

RNA secondary structure prediction

Exercise 1

Copy the following sequence

>1QTQ:B|PDBID|CHAIN|SEQUENCE
UGGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGCAUUCCGAGGUUCGAAUCCUCGUACCCCAGCCA

click on the link below and paste the above copied sequence in the text box area and then click the submit/proceed button to predict the secondary structure of the RNA sequence

RNA fold Web server

RNA secondary structure prediction

No comments: