Exercise 1
Copy the following sequence
>1QTQ:B|PDBID|CHAIN|SEQUENCE
UGGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGCAUUCCGAGGUUCGAAUCCUCGUACCCCAGCCA
click on the link below and paste the above copied sequence in the text box area and then click the submit/proceed button to predict the secondary structure of the RNA sequence
RNA fold Web server
RNA secondary structure prediction
No comments:
Post a Comment