Monday, February 4, 2019

Discontinued Blog!!

Hi There,

Thanks for stopping by. This is an old blog of mine. I have discontinued it long ago. For more recent and current information, please visit:

Technical: https://rohitfarmer.github.io
Creative: https://rohitfarmer.carrd.co

Thank you,

Rohit

Tuesday, May 15, 2012

Monday, April 25, 2011

Wednesday, February 23, 2011

Lecture PPT for Protein Information Resource

Power Point Presentation for Protein Information Resources (Covering Primary and Composite Protein Databases)

Download Link

Note : This PPT is only intended to be used by the Students of B.Tech. (MCE, IM, BPT) 6th semester, JSBB, SHIATS. The author does not take any responsibility of its use outside the university campus.

Saturday, November 7, 2009

I Am Happy

I Am Happy

I am happy because
God has made me in His own Image

I am happy because
Through Jesus Christ I have Eternal life

I am happy because
Lord has a Plan for me, the Plan to Prosper and not to Harm me

I am happy because
Lord has promised that I will be the Head and not the Tail

I am happy because
I have a Strong Father, a Caring Mother and an Annoying and Talented Younger Brother

I am happy because
I have Sensitive Sushant, Sensible Shalabh, Crazy Utsav and Lovely Garima

I am happy because
I am in Love with the Prettiest Girl on the face of Earth

I am happy because
I have a Job as an Assistant Professor and has the responsibility to shape up the young minds

I am happy because
I have B.Tech, M.Tech and would be B.Th degree

I am happy because
I will be doing my PhD from abroad

I am happy because
I am a Geek and a computer Freek

I am happy because
I have the Prettiest House anyone can

I am happy because
Big Scientists know me

I am happy because
I have Colleagues which are Sweet but Annoying sometimes

I am happy because
I am Cute and Nice like a Cherry on Ice

I am happy because
I am Dumb and do not understand which i need not to understand

I am happy because
Girls smile when they see me without knowing the reason

I am happy because
Google search has Three pages on my Name

I am happy because
I have a Blackbelt in Taekwondo

I am happy because
I know the taste of Wine and the Sunshine

I am happy because
One day i will be on Top of the World and in Hearts of many people

I am happy because
I know that “I Love You” is not a question to be answered

I am happy because
I am I
And I am Rohit Farmer

7th November, 2009

Saturday, August 1, 2009

Life makes you Learn

Years of my life taught me lot of things
i learnt the difference between liking someone and loving someone.
i learnt friendship doesn't always lead to commitment, and holding a hand isn't the same as holding a heart.
i learnt that telling a secret doesn't mean it will be kept, and promises can be broken as easily as hearts.
i had my heart broken probably more than once and it hurts harder every time.
i learnt that some goodbyes really are forever, and sometimes smiles don't make everything okay.
i learnt to move on but never learnt to forget
.
i learnt that life never turns out to be the way you want it to be.
Life doesn't give you the people you want
it gives you the people you need; to help you,
to hurt you, to love you, to leave you to make
you into the person you were meant to be.

Sunday, July 5, 2009

VISION AND REALITY

"And the parched ground shall become a pool." Isaiah 35:7

We always have visions, before a thing is made real. When we realize that although the vision is real, it is not real in us, then is the time that Satan comes in with his temptations, and we are apt to say it is no use to go on. Instead of the vision becoming real, there has come the valley of humiliation.

"Life is not as idle ore,
But iron dug from central gloom,
And batter'd by the shocks of doom
To shape and use."

God gives us the vision, then He takes us down to the valley to batter us into the shape of the vision, and it is in the valley that so many of us faint and give way. Every vision will be made real if we will have patience. Think of the enormous leisure of God! He is never in a hurry. We are always in such a frantic hurry. In the light of the glory of the vision we go forth to do things, but the vision is not real in us yet; and God has to take us into the valley, and put us through fires and floods to batter us into shape, until we get to the place where He can trust us with the veritable reality. Ever since we had the vision God has been at work, getting us into the shape of the ideal, and over and over again we escape from His hand and try to batter ourselves into our own shape.

The vision is not a castle in the air, but a vision of what God wants you to be. Let Him put you on His wheel and whirl you as He likes, and as sure as God is God and you are you, you will turn out exactly in accordance with the vision. Don't lose heart in the process. If you have ever had the vision of God, you may try as you like to be satisfied on a lower level, but God will never let you.


Source :- myutmost.org

Friday, July 3, 2009

ONE OF GOD'S GREAT DON'TS

"Fret not thyself, it tendeth only to evil doing." Psalm 37:8 (R.V.)

Fretting means getting out at elbows mentally or spiritually. It is one thing to say "Fret not," but a very different thing to have such a disposition that you find yourself able not to fret. It sounds so easy to talk about "resting in the Lord" and "waiting patiently for Him" until the nest is upset - until we live, as so many are doing, in tumult and anguish, is it possible then to rest in the Lord? If this "don't" does not work there, it will work nowhere. This "don't" must work in days of perplexity as well as in days of peace, or it never will work. And if it will not work in your particular case, it will not work in anyone else's case. Resting in the Lord does not depend on external circumstances at all, but on your relationship to God Himself. 

Fussing always ends in sin. We imagine that a little anxiety and worry are an indication of how really wise we are; it is much more an indication of how really wicked we are. Fretting springs from a determination to get our own way. Our Lord never worried and He was never anxious, because He was not "out" to realize His own ideas; He was "out" to realize God's ideas. Fretting is wicked if you are a child of God. 

Have you been bolstering up that stupid soul of yours with the idea that your circumstances are too much for God? Put all "supposing" on one side and dwell in the shadow of the Almighty. Deliberately tell God that you will not fret about that thing. All our fret and worry is caused by calculating without God.

Source :- www.myutmost.org

The Basics of Life

We need to get back
To the basics of life
A heart that is pure
And a love that is blind
A faith that is fervently
grounded in Christ
The hope that endures for all times
These are the basics,
we need to get back
To the basics of life

Saturday, May 9, 2009

Monday, January 26, 2009

RNA secondary structure prediction

Exercise 1

Copy the following sequence

>1QTQ:B|PDBID|CHAIN|SEQUENCE
UGGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGCAUUCCGAGGUUCGAAUCCUCGUACCCCAGCCA

click on the link below and paste the above copied sequence in the text box area and then click the submit/proceed button to predict the secondary structure of the RNA sequence

RNA fold Web server

RNA secondary structure prediction

Wednesday, January 21, 2009

The Cell

For biologists the cell is the functional and structural unit of all known living organisms.

For gamers :-

Cell is a microprocessor architecture jointly developed by Sony Computer Entertainment, Toshiba, and IBM, an alliance known as "STI". The architectural design and first implementation were carried out at the STI Design Center in Austin, Texas over a four-year period beginning March 2001 on a budget reported by IBM as approaching US$400 million.[1] Cell is shorthand for Cell Broadband Engine Architecture, commonly abbreviated CBEA in full or Cell BE in part. Cell combines a general-purpose Power Architecture core of modest performance with streamlined coprocessing elements which greatly accelerate multimedia and vector processing applications, as well as many other forms of dedicated computation.

The first major commercial application of Cell was in Sony's PlayStation 3 game console.

Check out Cell Project at IBM

Friday, September 5, 2008

Ex Google Staffers Launch Cuil Search

Former Google search experts have revealed what they hope will be a threat to their previous employer’s dominant search service. The new engine is named Cuil, after the Gaelic word for “wisdom.” It’s perhaps not the catchiest name ever, but neither was Google, before it became a household name. The people at Cuil claim the new search engine uses far fewer servers than the search leader, yet indexes a much larger chunk of the Web. It also purports to produce more relevant search results, because the information it returns in response to queries is based on organization of ideas rather than link popularity. A final—and important—differentiator from Google is that Cuil, according to the company, doesn’t collect information on its users’ search histories or IP addresses. Of course, that last advantage is significant only if the product is worth using.

Google Chrome Beta- Rock On

With the surprise launch of the beta of Google Chrome, the Web and search giant has already changed the current browser landscape and is poised to potentially change the future of the Web.

And before I go any further I just want to clarify that I’ve only had a short few hours with the new Google Web browser, and subsequent and sustained use may reveal issues that would change my view of the browser.

But right now, based on this short amount of testing, Google Chrome may just be the most impressive new Web browser that I have ever seen. While there are still a few beta hiccups, much of the experience of using Google Chrome just feels like the way that a browser should work.

Of course, a lot of the credit for the solid features and capabilities of the Google Chrome beta should go to its competitors, including Firefox, Opera, Safari and, yes, even Internet Explorer. That’s because there isn’t much in Google Chrome that is completely new. Most of the features, from tabs to private browsing modes, are already found in competing browsers.

But the way that Google Chrome implements these features is done very well in most cases, resulting in a browser with excellent usability and core capabilities.

When launching Google Chrome, which currently is only available for Windows systems, the browser walks users through some of the interface features, such as the integrated search and address bar (the default search engine is Google but users can change it to competing search sites) and the new tab features, which are pretty much lifted completely from Opera’s speed dial feature.

As one surfs using Google Chrome, more of the features start to take shape. Clicking a new tab shows thumbnails of frequently visited sites and links to bookmarks. I liked this feature although I would have preferred if it let users customize the thumbnailed sites rather than only using the most visited sites.

Like Internet Explorer 8, Chrome has a private browsing mode, which is called incognito mode. A new window can be launched in this mode or you can choose to launch a window from a link directly into incognito mode. In this mode no traces of a Web surfing session (such as cookies) are saved, and users know when they are in incognito mode by the spy figure shown in the upper left-hand corner of the browser.

The address bar in Chrome combines both search and standard URL entry. This took a little getting used to but once I got the hang of it I liked this single-box method of using a browser address bar.

Another interesting feature of Google Chrome is its integrated use of Google Gears. Called application shortcuts in the browser, this feature lets users take any Web application and save it as a desktop-based Web application, with its own launch icons in the Start menu, Quick Launch and desktop.

Like other browsers, Google Chrome will warn users when they go to a secure site where the certificate doesn’t match the address entered. Also, in one of the only areas that I’ve found so far where the browser integrated with Google Search, when a Web site failed to launch, the error page displayed by Chrome gave the option of launching the site from Google Cache.

During my short amount of testing I never ran into any unstable sites or applications so I was unable to test the new feature where every tab in Google Chrome runs as a separate process, which should keep a single site or application from bringing down the entire browser.

Google Chrome is based on the WebKit engine, which has excellent standards support. In my short amount of testing I have yet to run into a site that didn’t work in Chrome, though I am sure they are out there.

All in all, the beta of Google Chrome is an exciting and impressive new entry into the Web browser field. As I continue to test this beta and subsequent releases I’ll keep you updated on any new discoveries or possible issues with the browser.

Those wanting to try out the Google Chrome beta can find it at www.google.com/chrome.

Exctracts from eWeek.

Tuesday, September 2, 2008

The Ribosome

Notes on The Ribosome (part of translation)

Download Link

Wednesday, August 20, 2008