Saturday, May 9, 2009

Monday, January 26, 2009

RNA secondary structure prediction

Exercise 1

Copy the following sequence

>1QTQ:B|PDBID|CHAIN|SEQUENCE
UGGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGCAUUCCGAGGUUCGAAUCCUCGUACCCCAGCCA

click on the link below and paste the above copied sequence in the text box area and then click the submit/proceed button to predict the secondary structure of the RNA sequence

RNA fold Web server

RNA secondary structure prediction

Wednesday, January 21, 2009

The Cell

For biologists the cell is the functional and structural unit of all known living organisms.

For gamers :-

Cell is a microprocessor architecture jointly developed by Sony Computer Entertainment, Toshiba, and IBM, an alliance known as "STI". The architectural design and first implementation were carried out at the STI Design Center in Austin, Texas over a four-year period beginning March 2001 on a budget reported by IBM as approaching US$400 million.[1] Cell is shorthand for Cell Broadband Engine Architecture, commonly abbreviated CBEA in full or Cell BE in part. Cell combines a general-purpose Power Architecture core of modest performance with streamlined coprocessing elements which greatly accelerate multimedia and vector processing applications, as well as many other forms of dedicated computation.

The first major commercial application of Cell was in Sony's PlayStation 3 game console.

Check out Cell Project at IBM

Friday, September 5, 2008

Ex Google Staffers Launch Cuil Search

Former Google search experts have revealed what they hope will be a threat to their previous employer’s dominant search service. The new engine is named Cuil, after the Gaelic word for “wisdom.” It’s perhaps not the catchiest name ever, but neither was Google, before it became a household name. The people at Cuil claim the new search engine uses far fewer servers than the search leader, yet indexes a much larger chunk of the Web. It also purports to produce more relevant search results, because the information it returns in response to queries is based on organization of ideas rather than link popularity. A final—and important—differentiator from Google is that Cuil, according to the company, doesn’t collect information on its users’ search histories or IP addresses. Of course, that last advantage is significant only if the product is worth using.

Google Chrome Beta- Rock On

With the surprise launch of the beta of Google Chrome, the Web and search giant has already changed the current browser landscape and is poised to potentially change the future of the Web.

And before I go any further I just want to clarify that I’ve only had a short few hours with the new Google Web browser, and subsequent and sustained use may reveal issues that would change my view of the browser.

But right now, based on this short amount of testing, Google Chrome may just be the most impressive new Web browser that I have ever seen. While there are still a few beta hiccups, much of the experience of using Google Chrome just feels like the way that a browser should work.

Of course, a lot of the credit for the solid features and capabilities of the Google Chrome beta should go to its competitors, including Firefox, Opera, Safari and, yes, even Internet Explorer. That’s because there isn’t much in Google Chrome that is completely new. Most of the features, from tabs to private browsing modes, are already found in competing browsers.

But the way that Google Chrome implements these features is done very well in most cases, resulting in a browser with excellent usability and core capabilities.

When launching Google Chrome, which currently is only available for Windows systems, the browser walks users through some of the interface features, such as the integrated search and address bar (the default search engine is Google but users can change it to competing search sites) and the new tab features, which are pretty much lifted completely from Opera’s speed dial feature.

As one surfs using Google Chrome, more of the features start to take shape. Clicking a new tab shows thumbnails of frequently visited sites and links to bookmarks. I liked this feature although I would have preferred if it let users customize the thumbnailed sites rather than only using the most visited sites.

Like Internet Explorer 8, Chrome has a private browsing mode, which is called incognito mode. A new window can be launched in this mode or you can choose to launch a window from a link directly into incognito mode. In this mode no traces of a Web surfing session (such as cookies) are saved, and users know when they are in incognito mode by the spy figure shown in the upper left-hand corner of the browser.

The address bar in Chrome combines both search and standard URL entry. This took a little getting used to but once I got the hang of it I liked this single-box method of using a browser address bar.

Another interesting feature of Google Chrome is its integrated use of Google Gears. Called application shortcuts in the browser, this feature lets users take any Web application and save it as a desktop-based Web application, with its own launch icons in the Start menu, Quick Launch and desktop.

Like other browsers, Google Chrome will warn users when they go to a secure site where the certificate doesn’t match the address entered. Also, in one of the only areas that I’ve found so far where the browser integrated with Google Search, when a Web site failed to launch, the error page displayed by Chrome gave the option of launching the site from Google Cache.

During my short amount of testing I never ran into any unstable sites or applications so I was unable to test the new feature where every tab in Google Chrome runs as a separate process, which should keep a single site or application from bringing down the entire browser.

Google Chrome is based on the WebKit engine, which has excellent standards support. In my short amount of testing I have yet to run into a site that didn’t work in Chrome, though I am sure they are out there.

All in all, the beta of Google Chrome is an exciting and impressive new entry into the Web browser field. As I continue to test this beta and subsequent releases I’ll keep you updated on any new discoveries or possible issues with the browser.

Those wanting to try out the Google Chrome beta can find it at www.google.com/chrome.

Exctracts from eWeek.