Sunday, July 5, 2009

VISION AND REALITY

"And the parched ground shall become a pool." Isaiah 35:7

We always have visions, before a thing is made real. When we realize that although the vision is real, it is not real in us, then is the time that Satan comes in with his temptations, and we are apt to say it is no use to go on. Instead of the vision becoming real, there has come the valley of humiliation.

"Life is not as idle ore,
But iron dug from central gloom,
And batter'd by the shocks of doom
To shape and use."

God gives us the vision, then He takes us down to the valley to batter us into the shape of the vision, and it is in the valley that so many of us faint and give way. Every vision will be made real if we will have patience. Think of the enormous leisure of God! He is never in a hurry. We are always in such a frantic hurry. In the light of the glory of the vision we go forth to do things, but the vision is not real in us yet; and God has to take us into the valley, and put us through fires and floods to batter us into shape, until we get to the place where He can trust us with the veritable reality. Ever since we had the vision God has been at work, getting us into the shape of the ideal, and over and over again we escape from His hand and try to batter ourselves into our own shape.

The vision is not a castle in the air, but a vision of what God wants you to be. Let Him put you on His wheel and whirl you as He likes, and as sure as God is God and you are you, you will turn out exactly in accordance with the vision. Don't lose heart in the process. If you have ever had the vision of God, you may try as you like to be satisfied on a lower level, but God will never let you.


Source :- myutmost.org

Friday, July 3, 2009

ONE OF GOD'S GREAT DON'TS

"Fret not thyself, it tendeth only to evil doing." Psalm 37:8 (R.V.)

Fretting means getting out at elbows mentally or spiritually. It is one thing to say "Fret not," but a very different thing to have such a disposition that you find yourself able not to fret. It sounds so easy to talk about "resting in the Lord" and "waiting patiently for Him" until the nest is upset - until we live, as so many are doing, in tumult and anguish, is it possible then to rest in the Lord? If this "don't" does not work there, it will work nowhere. This "don't" must work in days of perplexity as well as in days of peace, or it never will work. And if it will not work in your particular case, it will not work in anyone else's case. Resting in the Lord does not depend on external circumstances at all, but on your relationship to God Himself. 

Fussing always ends in sin. We imagine that a little anxiety and worry are an indication of how really wise we are; it is much more an indication of how really wicked we are. Fretting springs from a determination to get our own way. Our Lord never worried and He was never anxious, because He was not "out" to realize His own ideas; He was "out" to realize God's ideas. Fretting is wicked if you are a child of God. 

Have you been bolstering up that stupid soul of yours with the idea that your circumstances are too much for God? Put all "supposing" on one side and dwell in the shadow of the Almighty. Deliberately tell God that you will not fret about that thing. All our fret and worry is caused by calculating without God.

Source :- www.myutmost.org

The Basics of Life

We need to get back
To the basics of life
A heart that is pure
And a love that is blind
A faith that is fervently
grounded in Christ
The hope that endures for all times
These are the basics,
we need to get back
To the basics of life

Saturday, May 9, 2009

Monday, January 26, 2009

RNA secondary structure prediction

Exercise 1

Copy the following sequence

>1QTQ:B|PDBID|CHAIN|SEQUENCE
UGGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGCAUUCCGAGGUUCGAAUCCUCGUACCCCAGCCA

click on the link below and paste the above copied sequence in the text box area and then click the submit/proceed button to predict the secondary structure of the RNA sequence

RNA fold Web server

RNA secondary structure prediction

Wednesday, January 21, 2009

The Cell

For biologists the cell is the functional and structural unit of all known living organisms.

For gamers :-

Cell is a microprocessor architecture jointly developed by Sony Computer Entertainment, Toshiba, and IBM, an alliance known as "STI". The architectural design and first implementation were carried out at the STI Design Center in Austin, Texas over a four-year period beginning March 2001 on a budget reported by IBM as approaching US$400 million.[1] Cell is shorthand for Cell Broadband Engine Architecture, commonly abbreviated CBEA in full or Cell BE in part. Cell combines a general-purpose Power Architecture core of modest performance with streamlined coprocessing elements which greatly accelerate multimedia and vector processing applications, as well as many other forms of dedicated computation.

The first major commercial application of Cell was in Sony's PlayStation 3 game console.

Check out Cell Project at IBM